Share your repls and programming experiences

← Back to all posts
Open Night 2020. Nucleotide Calculator Example
mrmcuffe (0)

Welcome to Open Night!
As part of the Game Programming and Data Science course our students each created a python program that can analyse Nucleotide sequences - a Nucleotide Calculator!
Nucleotide are structural building blocks of DNA and the base consists of one of four chemicals:

  • adenosine (A),
  • cytidine (C),
  • guanine (G),
  • thymidine (T).

As a sequence they often look like this;
CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGA

Try it in our calculator!

This example was modified by one of our students specifically to welcome you to our open night.

Press the play button below, or make your own changes.